Content from Introducing the Shell


Last updated on 2024-06-17 | Edit this page

Estimated time: 20 minutes

Overview

Questions

  • What is a command shell and why would I use one?
  • How can I move around on my computer?
  • How can I see what files and directories I have?
  • How can I specify the location of a file or directory on my computer?

Objectives

  • Describe key reasons for learning shell.
  • Navigate your file system using the command line.
  • Access and read help files for bash programs and use help files to identify useful command options.
  • Demonstrate the use of tab completion, and explain its advantages.

What is a shell and why should I care?


A shell is a computer program that presents a command line interface which allows you to control your computer using commands entered with a keyboard instead of controlling graphical user interfaces (GUIs) with a mouse/keyboard/touchscreen combination.

There are many reasons to learn about the shell:

  • Many bioinformatics tools can only be used through a command line interface. Many more have features and parameter options which are not available in the GUI. BLAST is an example. Many of the advanced functions are only accessible to users who know how to use a shell.
  • The shell makes your work less boring. In bioinformatics you often need to repeat tasks with a large number of files. With the shell, you can automate those repetitive tasks and leave you free to do more exciting things.
  • The shell makes your work less error-prone. When humans do the same thing a hundred different times (or even ten times), they’re likely to make a mistake. Your computer can do the same thing a thousand times with no mistakes.
  • The shell makes your work more reproducible. When you carry out your work in the command-line (rather than a GUI), your computer keeps a record of every step that you’ve carried out, which you can use to re-do your work when you need to. It also gives you a way to communicate unambiguously what you’ve done, so that others can inspect or apply your process to new data.
  • Many bioinformatic tasks require large amounts of computing power and can’t realistically be run on your own machine. These tasks are best performed using remote computers or cloud computing, which can only be accessed through a shell.

In this lesson you will learn how to use the command line interface to move around in your file system. We will learn the basics of the shell by manipulating some data files on a remote Unix server.

Broad login servers


All Broadies have access to Broad login servers. These are ’remote server’s, a computer that is not the one you are working on right now.

On a Mac or Linux machine, you can reach the login servers using a program called “Terminal”, which is already available on your computer. The Terminal is a window into which we will type commands. If you’re using Windows, you’ll use SecureCRT.

How to access the remote server


  1. Connect to the Broad-Internal wireless network.
  2. Launch your preferred SSH client, such as Terminal (Mac or Unix) or SecureCRT (Windows)
  3. Log in to a Broad login server using the instructions on the Broad Intranet.

The portion of your Broad email address before the @ symbol is your Broad username. Your Unix password is the the same one you use for your Broad-issued computer.

After logging in, you will see a screen showing something like this:

OUTPUT

Last login: Tue Apr 23 08:33:43 2024 from 10.75.224.147
--------------------------------------------------------------
Welcome to the host named login01
RedHat 7.9 x86_64
--------------------------------------------------------------
Puppet:        7.29.1
Facter:        4.6.1
Environment:   production
FQDN:          login01.broadinstitute.org
VLAN:          32
IP:            69.173.65.17
Born On:       2019-07-28
Uptime:        18 days
Model:         VMware Virtual Platform
CPUs:          2
Memory:        7.62 GiB
--------------------------------------------------------------
 IMPORTANT: This login host is a SHARED resource. Please limit
 your usage to editing, simple scripts, and small data transfer
 tasks. To encourage mindful use, limits have been put in place
 including memory limitations.

 To read more about this service, see https://broad.io/login.

 ################## Monthly Reboot Schedule ##################
 Since there is no convenient time to reboot login hosts we
 are establishing a monthly rotation.

 login01   - 1st Sunday of each month at 6 PM
 login02   - 2nd Sunday of each month at 6 PM
 login03   - 3rd Sunday of each month at 6 PM
 login04   - 4th Sunday of each month at 6 PM

 If starting a long session, choose the host rebooted last
--------------------------------------------------------------
This computer system is the property of the Broad Institute.

It is for authorized use only. By using this system all users
acknowledge notice of, and agree to comply with, Broad's
Acceptable Use (broad.io/AcceptableUse).

Unauthorized or improper use of this system may result in
administrative disciplinary action and/or other sanctions.

By continuing to use this system you indicate
your awareness of and consent to Broad's Acceptable Use Policy.
(broad.io/AcceptableUse).

Log off immediately if you do not agree to the conditions
stated in this warning.
--------------------------------------------------------------

This provides a lot of information about the login servers. Continuing means you agree to Broad’s acceptable use policy. If you disagree, please type exit. Otherwise let’s continue. You can clear your screen using the clear command.

Type the word clear into the terminal and press the Enter key.

BASH

$ clear

This will scroll your screen down to give you a fresh screen and will make it easier to read. You haven’t lost any of the information on your screen. If you scroll up, you can see everything that has been output to your screen up until this point.

Tip

Hot-key combinations are shortcuts for performing common commands. The hot-key combination for clearing the console is Ctrl+L. Feel free to try it and see for yourself.


The part of the operating system that manages files and directories is called the file system. It organizes our data into files, which hold information, and directories (also called “folders”), which hold files or other directories.

Several commands are frequently used to create, inspect, rename, and delete files and directories.

$

The dollar sign is a prompt, which shows us that the shell is waiting for input; your shell may use a different character as a prompt and may add information before the prompt. When typing commands, either from these lessons or from other sources, do not type the prompt, only the commands that follow it.

You may have a prompt (the characters to the left of the cursor) that looks different from the $ sign character used here. If you would like to change your prompt to match the example prompt, first type the command: echo $PS1 into your shell, followed by pressing the Enter key.

This will print the bash special characters that are currently defining your prompt. To change the prompt to a $ (followed by a space), enter the command: PS1='$ ' Your window should look like our example in this lesson.

To change back to your original prompt, type in the output of the previous command echo $PS1 (this will be different depending on the original configuration) between the quotes in the following command: PS1=""

For example, if the output of echo $PS1 was \u@\h:\w $, then type those characters between the quotes in the above command: PS1="\u@\h:\w $ ". Alternatively, you can reset your original prompt by exiting the shell and opening a new session.

This isn’t necessary to follow along (in fact, your prompt may have other helpful information you want to know about). This is up to you!

Let’s find out where we are by running a command called pwd (which stands for “print working directory”). At any moment, our current working directory is our current default directory, i.e., the directory that the computer assumes we want to run commands in, unless we explicitly specify something else. Here, the computer’s response is /home/unix/<username>, also known as your home directory. It is a common convention to use angle brackets as a hint to substitute an appropriate value (without the brackets).

BASH

$ pwd

OUTPUT

/home/unix/<username>

Your screen will show your username where you see in the output box above.

Let’s look at our file system. We can see what files and subdirectories are in this directory by running ls, which stands for “listing”:

BASH

$ ls

OUTPUT

ls prints the names of the files and directories in the current directory in alphabetical order, arranged neatly into columns. Your output may look different if you already have files in your home directory. Let’s get some example directories and files so we can practice navigating in a Unix environment.

On most Unix systems, you can grab a file over the internet using a tool called wget.

BASH

$ wget https://github.com/jlchang/2024-05-09-Unix_Shell_pilot/raw/main/learners/files/cb_unix_shell.tgz

OUTPUT

--2024-04-26 08:57:28--  https://github.com/jlchang/2024-05-09-Unix_Shell_pilot/raw/jlc_episode1_edits/learners/files/cb_unix_shell.tgz
Resolving github.com (github.com)... 140.82.113.4
Connecting to github.com (github.com)|140.82.113.4|:443... connected.
HTTP request sent, awaiting response... 302 Found
Location: https://raw.githubusercontent.com/jlchang/2024-05-09-Unix_Shell_pilot/jlc_episode1_edits/learners/files/cb_unix_shell.tgz [following]
--2024-04-26 08:57:28--  https://raw.githubusercontent.com/jlchang/2024-05-09-Unix_Shell_pilot/jlc_episode1_edits/learners/files/cb_unix_shell.tgz
Resolving raw.githubusercontent.com (raw.githubusercontent.com)... 185.199.109.133, 185.199.110.133, 185.199.111.133, ...
Connecting to raw.githubusercontent.com (raw.githubusercontent.com)|185.199.109.133|:443... connected.
HTTP request sent, awaiting response... 200 OK
Length: 115379 (113K) [application/octet-stream]
Saving to: ‘cb_unix_shell.tgz’

cb_unix_shell.tgz              100%[===================================================>] 112.67K  --.-KB/s    in 0.1s

2024-04-26 08:57:29 (892 KB/s) - ‘cb_unix_shell.tgz’ saved [115379/115379]

Now if we ls

BASH

$ ls

OUTPUT

cb_unix_shell.tgz

We downloaded a “tarball”. It’s a compressed file that can be unpacked. Let’s unpack it!

BASH

$ tar -xzf cb_unix_shell.tgz

Now if we ls again

BASH

$ ls

OUTPUT

cb_unix_shell  cb_unix_shell.tgz

Let’s explore the cb_unix_shell subdirectory.

The command to change locations in our file system is cd, followed by a directory name to change our working directory. cd stands for “change directory”.

Let’s say we want to navigate to the cb_unix_shell directory we saw above. We can use the following command to get there:

BASH

$ cd cb_unix_shell

Let’s look at what is in this directory:

BASH

$ ls

OUTPUT

Dahl  Seuss  authors.txt  data  prodinfo454

We can tell ls to display more information for each item in the directory by giving it a command line flag. Use the -l option for the ls command, like so:

BASH

$ ls -l

OUTPUT

total 515
drwxr-sr-x   4 jlchang puppet    94 May  8 01:53 Dahl
drwxr-sr-x   4 jlchang puppet    68 May  8 01:56 Seuss
-rw-r--r--   1 jlchang puppet   155 Mar 14  2013 authors.txt
-rw-r--r--   1 jlchang puppet 19085 Mar 14  2013 data
drwxr-sr-x 268 jlchang puppet 19483 May  8 01:55 prodinfo454

Note: your output will show your username where you see jlchang above.

The additional information given includes the name of the owner of the file, when the file was last modified, and whether the current user has permission to read and write to the file.

ls has lots of other options. To find out what they are, we can type:

BASH

$ man ls

man (short for manual) displays detailed documentation (also referred as man page or man file) for bash commands. It is a powerful resource to explore bash commands, understand their usage and flags. Some manual files are very long. You can scroll through the file using your keyboard’s down arrow or use the Space key to go forward one page and the b key to go backwards one page. When you are done reading, hit q to quit.

We can make the ls output more comprehensible by using the flag -F, which tells ls to add a trailing / to the names of directories:

BASH

$ ls -F

OUTPUT

Dahl/  Seuss/  authors.txt  data  prodinfo454/

Anything with a “/” after it is a directory. Things with a “*” after them are programs. If there are no decorations, it’s a file. Broad servers use ls -CF by default. Knowing ls -F can be useful on servers that show plain ls output. For a color-coded option, try ls --color=auto.

No one can possibly learn all of these arguments, that’s what the manual page is for. You can (and should) refer to the manual page or other help files as needed.

Let’s go into the Dahl directory and see what is in there.

BASH

$ cd Dahl
$ ls -F

OUTPUT

Charlie_and_the_Chocolate_Factory/  James_and_the_Giant_Peach/

This directory contains two subdirectories with long names. Unix has a great trick to minimize typing long names!

Shortcut: Tab Completion

Typing out file or directory names can waste a lot of time and it’s easy to make typing mistakes. Instead we can use tab complete as a shortcut. When you start typing out the name of a directory or file, then hit the Tab key, the shell will try to fill in the rest of the directory or file name.

From the Dahl directory:

BASH

$ cd J<tab>

The shell will fill in the rest of the directory name for James_and_the_Giant_Peach.

Now change directories to James_and_the_Giant_Peach in Dahl

BASH

$ cd James_and_the_Giant_Peach

Using tab complete can be very helpful. However, it will only autocomplete a file or directory name if you’ve typed enough characters to provide a unique identifier for the file or directory you are trying to access.

For example, if we now try to list the files which names start with Au by using tab complete:

BASH

$ ls Au<tab>

The shell auto-completes your command to Aunt_Sp, because there are two files in the directory that begin with Aunt_Sp. When you hit Tab again, the shell will list the possible choices.

BASH

$ ls Aunt_Sp<tab><tab>

OUTPUT

Aunt_Spiker  Aunt_Sponge

Tab completion can also fill in the names of programs, which can be useful if you remember the beginning of a program name.

BASH

$ pw<tab><tab>

OUTPUT

pwck      pwconv    pwd       pwdx      pwunconv

Displays the name of every program that starts with pw.

Summary


We now know how to move around our file system using the command line. This gives us an advantage over interacting with the file system through a GUI as it allows us to work on a remote server, carry out the same set of operations on a large number of files quickly, and opens up many opportunities for using bioinformatic software that is only available in command line versions.

In the next few episodes, we’ll be expanding on these skills and seeing how using the command line shell enables us to make our workflow more efficient and reproducible.

Key Points

  • The shell gives you the ability to work more efficiently by using keyboard commands rather than a GUI.
  • Useful commands for navigating your file system include: ls, pwd, and cd.
  • Most commands take options (flags) which begin with a -.
  • Tab completion can reduce errors from mistyping and make work more efficient in the shell.

Content from Navigating Files and Directories


Last updated on 2024-06-17 | Edit this page

Estimated time: 50 minutes

Overview

Questions

  • How can I perform operations on files outside of my working directory?
  • What are some navigational shortcuts I can use to make my work more efficient?

Objectives

  • Use a single command to navigate multiple steps in your directory structure, including moving backwards (one level up).
  • Perform operations on files in directories outside your working directory.
  • Work with hidden directories and hidden files.
  • Interconvert between absolute and relative paths.
  • Employ navigational shortcuts to move around your file system.

Moving around the file system


Download cb_unix_shell.tgz to your home directory and unpack it.

BASH

$ cd
$ wget https://github.com/jlchang/2024-05-09-Unix_Shell_pilot/raw/main/learners/files/cb_unix_shell.tgz
$ tar -xzf cb_unix_shell.tgz

We’ve learned how to use pwd to find our current location within our file system. We’ve also learned how to use cd to change locations and ls to list the contents of a directory. Now we’re going to learn some additional commands for moving around within our file system.

Use the commands we’ve learned so far to navigate to the cb_unix_shell/Dahl directory, if you’re not already there.

BASH

$ cd
$ cd cb_unix_shell
$ cd Dahl

What if we want to move back up and out of this directory and to our top level directory? Can we type cd cb_unix_shell? Try it and see what happens.

BASH

$ cd cb_unix_shell

OUTPUT

-bash: cd: cb_unix_shell: No such file or directory

Your computer looked for a directory or file called cb_unix_shell within the directory you were already in. It didn’t know you wanted to look at a directory level above the one you were located in.

We have a special command to tell the computer to move us back or up one directory level.

BASH

$ cd ..

Now we can use pwd to make sure that we are in the directory we intended to navigate to, and ls to check that the contents of the directory are correct.

BASH

$ pwd

OUTPUT

/home/unix/jlchang/cb_unix_shell

Note: your output will show your username where you see jlchang above.

BASH

$ ls

OUTPUT

Dahl  Seuss  authors.txt  data  prodinfo454

From this output, we can see that .. did indeed take us back one level in our file system.

You can chain these together like so:

BASH

$ ls ../../

prints the contents of /home/unix.

Finding hidden directories

First navigate to the cb_unix_shell directory. There is a hidden directory within this directory. Explore the options for ls to find out how to see hidden directories. List the contents of the directory and identify the name of the text file in that directory.

Hint: hidden files and folders in Unix start with ., for example .my_hidden_directory

First use the man command to look at the options for ls.

BASH

$ man ls

The -a option is short for all and says that it causes ls to “not ignore entries starting with .” This is the option we want.

BASH

$ ls -a

OUTPUT

.  ..  .hidden  Dahl  Seuss  authors.txt  data  prodinfo454

The name of the hidden directory is .hidden. We can navigate to that directory using cd.

BASH

$ cd .hidden

And then list the contents of the directory using ls.

BASH

$ ls

OUTPUT

youfoundit.txt

The name of the text file is youfoundit.txt.

In most commands the flags can be combined together in no particular order to obtain the desired results/output.

ls -Fa
ls -laF

Examining the contents of other directories


By default, the ls commands lists the contents of the working directory (i.e. the directory you are in). You can always find the directory you are in using the pwd command. However, you can also give ls the names of other directories to view. Navigate to your home directory if you are not already there.

BASH

$ cd

Then enter the command:

BASH

$ ls cb_unix_shell

OUTPUT

Dahl  Seuss  authors.txt  data  prodinfo454

This will list the contents of the cb_unix_shell directory without you needing to navigate there.

The cd command works in a similar way.

Try entering:

BASH

$ cd
$ cd cb_unix_shell/Seuss

This will take you to the Seuss directory without having to go through the intermediate directory.

BASH

$ cd
$ ls cb_unix_shell/Seuss

OUTPUT

Cat_in_the_Hat  Green_Eggs_and_Ham

Full vs. Relative Paths


The cd command takes an argument which is a directory name. Directories can be specified using either a relative path or a full absolute path. The directories on the computer are arranged into a hierarchy. The full path tells you where a directory is in that hierarchy. Navigate to the home directory, then enter the pwd command.

BASH

$ cd
$ pwd

You will see:

OUTPUT

/home/unix/jlchang

Note: your output will show your username where you see jlchang above.

This is the full name of your home directory. This tells you that you are in a directory named with your username, which sits inside a directory called unix which is found in a directory called home which sits inside the very top directory in the hierarchy. The very top of the hierarchy is a directory called / which is usually referred to as the root directory. So, to summarize: your home directory is a directory in unix which is a directory in home which is a directory in /. More on root and home in the next section.

Now enter the following command:

BASH

$ cd cb_unix_shell/Seuss/Green_Eggs_and_Ham/

This jumps forward multiple levels to the Green_Eggs_and_Ham directory. Now go back to the home directory.

BASH

$ cd

I can also navigate to the Green_Eggs_and_Ham directory using:

BASH

$ cd /home/unix/<username>/cb_unix_shell/Seuss/Green_Eggs_and_Ham

You’ll need to substitute <username> with your Broad username (without angle brackets).

These two commands have the same effect, they both take us to the Green_Eggs_and_Ham directory. The first uses a relative path, giving only the address from the working directory (in this case, your home directory). The second uses the absolute path, giving the full address from the root directory. A full path always starts with a /. A relative path does not.

A relative path is like getting directions from someone on the street. They tell you to “go right at the stop sign, and then turn left on Main Street”. That works great if you’re standing there together, but not so well if you’re trying to tell someone how to get there from another country. A full path is like GPS coordinates. It tells you exactly where something is no matter where you are right now.

You can usually use either a full path or a relative path depending on what is most convenient or involves less typing.

Over time, it will become easier for you to keep a mental note of the structure of the directories that you are using and how to quickly navigate amongst them.

Relative path resolution

Using the filesystem diagram below, if pwd displays /Users/thing, what will ls ../backup display?

File System for Challenge Questions
  1. ../backup: No such file or directory
  2. 2012-12-01 2013-01-08 2013-01-27
  3. 2012-12-01/ 2013-01-08/ 2013-01-27/
  4. original pnas_final pnas_sub
  1. No: there is a directory backup in /Users.
  2. No: this is the content of Users/thing/backup, but with .. we asked for one level further up.
  3. No: see previous explanation. Also, we did not specify -F to display / at the end of the directory names.
  4. Yes: ../backup refers to /Users/backup.

The root directory is the highest level directory in your file system and contains files that are important for your computer to perform its daily work. While you will be using the root (/) at the beginning of your absolute paths, it is important that you avoid working with data in these higher-level directories, as your commands can permanently alter files that the operating system needs to function. In many cases, trying to run commands in root directories will require special permissions which are not discussed here, so it’s best to avoid them and work within your home directory. Dealing with the home directory is very common. The tilde character, ~, is a shortcut for your home directory. In our case, the root directory is three levels above our home directory, so cd or cd ~ will take you to /home/unix/<username> and cd / will take you to /. Navigate to the cb_unix_shell directory:

BASH

$ cd
$ cd cb_unix_shell

Then enter the command:

BASH

$ ls ~

OUTPUT

cb_unix_shell  cb_unix_shell.tgz

This prints the contents of your home directory, without you needing to type the full path.

The commands cd, and cd ~ are very useful for quickly navigating back to your home directory. We will be using the ~ character in later lessons to specify our home directory.

Key Points

  • The /, ~, and .. characters represent important navigational shortcuts.
  • Hidden files and directories start with . and can be viewed using ls -a.
  • Relative paths specify a location starting from the current location, while absolute paths specify a location from the root of the file system.

Content from Working with Files and Directories


Last updated on 2024-06-17 | Edit this page

Estimated time: 45 minutes

Overview

Questions

  • How can I view and search file contents?
  • How can I create, copy and delete files and directories?
  • How can I control who has permission to modify a file?
  • How can I repeat recently used commands?

Objectives

  • View, search within, copy, move, and rename files. Create new directories.
  • Use wildcards (*) to perform operations on multiple files.
  • Make a file read only.
  • Use the history command to view and repeat recently used commands.

Working with Files


Download cb_unix_shell.tgz to your home directory and unpack it.

BASH

$ cd
$ wget https://github.com/jlchang/2024-05-09-Unix_Shell_pilot/raw/main/learners/files/cb_unix_shell.tgz
$ tar -xzf cb_unix_shell.tgz

Wildcards

Navigate to our prodinfo454 directory:

BASH

$ cd
$ cd cb_unix_shell/prodinfo454

We are interested in looking at the sequencing runfolders in this directory.

BASH

$ ls

There are a lot of directories! The directories were created to be programmatically searchable so they follow a specific format: R_. We can list all runs from 2012 using the command:

BASH

$ ls R_2012_*

OUTPUT

R_2012_03_13_15_18_05_crinkle_DRobbins_DR031312lastRun646704:
aaLog.txt

R_2012_03_15_14_41_54_crinkle_DRobbins_DR031512Run760581:
aaLog.txt

The * character is a special type of character called a wildcard, which can be used to represent any number of any type of character (zero or more). Thus, R_2012_* matches every directory that starts with R_2012_.

Notice that ls lists each directory and the files in the directory. To show just the directories that match your search (and not show the directory contents), add the -d (aka. directories) flag.

BASH

$ ls -d R_2012_*

OUTPUT

R_2012_03_13_15_18_05_crinkle_DRobbins_DR031312lastRun646704  R_2012_03_15_14_41_54_crinkle_DRobbins_DR031512Run760581

You can also use wildcards on either end of your search (or both). Here we search for all runs on the machine “seabiscuit”:

BASH

$ ls -d *seabiscuit*

OUTPUT

R_2009_02_09_15_29_04_seabiscuit_levesque_SPG3kbDevRun705303
R_2009_03_16_13_49_01_seabiscuit_pfrere_march16tworegionRUN636092
R_2009_04_03_12_42_34_seabiscuit_levesque_DrocksLastRun647068
R_2009_04_09_14_23_35_seabiscuit_AHolling_krocksfirstRun713432
R_2009_04_15_14_29_08_seabiscuit_AHolling_Kamran041509run712591
R_2009_05_15_13_55_34_seabiscuit_AHolling_BacEscEscEscRun646819

lists only the directories with seabiscuit in the directory name.

This command:

BASH

$ ls /usr/bin/*.sh

OUTPUT

/usr/bin/gettext.sh   /usr/bin/lprsetup.sh         /usr/bin/setup-nsssysinit.sh
/usr/bin/lesspipe.sh  /usr/bin/rescan-scsi-bus.sh  /usr/bin/unix-lpr.sh

Lists every file in /usr/bin that ends in the characters .sh. Note that this output displays full paths to files, since each result starts with /.

Exercise

Do each of the following tasks from your current directory using a single ls command for each:

  1. List all of the files in /usr/bin that start with the letter ‘c’.
  2. List all of the files in /usr/bin that contain the letter ‘a’.
  3. List all of the files in /usr/bin that end with the letter ‘o’.

Bonus: List all of the files in /usr/bin that contain the letter ‘a’ or the letter ‘c’.

Hint: The bonus question requires a Unix wildcard that we haven’t talked about yet. Try searching the internet for information about Unix wildcards to find what you need to solve the bonus problem.

  1. ls /usr/bin/c*
  2. ls /usr/bin/*a*
  3. ls /usr/bin/*o

Bonus: ls /usr/bin/*[ac]*

Our data set: FASTQ files

Now that we know how to navigate around our directory structure, let’s start working with our sequencing files. We did a sequencing experiment and have two results files, which are stored in an untrimmed_fastq directory.

Using the commands we’ve learned so far, we’re going to navigate to a different filesystem. Starting from the root directory, we’re going to ‘broad’ instead of ‘home’. This filesystem is called /broad/hptmp (for high performance temporary). /broad/hptmp is available for Broadies who need a temporary space to do high performance computing work. Files in /broad/hptmp are automatically deleted after 14 days. We’ve created a computing_basics directory for today’s workshop.

Let’s navigate to the untrimmed_fastq directory in /broad/hptmp/computing_basics.

Download untrimmed_fastq.zip to your home directory and unpack it.

BASH

$ cd
wget https://github.com/jlchang/2024-05-09-Unix_Shell_pilot/raw/main/learners/files/untrimmed_fastq.zip
$ unzip untrimmed_fastq.zip

Then, in the following instructions, wherever you see /broad/hptmp/computing_basics substitute ~/untrimmed_fastq.

Exercise

echo is a built-in shell command that writes its arguments, like a line of text to standard output. The echo command can also be used with pattern matching characters, such as wildcard characters. Here we will use the echo command to see how the wildcard character is interpreted by the shell.

BASH

$ echo *.fastq

OUTPUT

SRR097977.fastq SRR098026.fastq

The * is expanded to include any file that ends with .fastq. We can see that the output of echo *.fastq is the same as that of ls *.fastq.

What would the output look like if the wildcard could not be matched? Compare the outputs of echo *.missing and ls *.missing.

Later on, when you learn to string together Unix commands, echo can be useful for injecting desirable text where you need it.

BASH

$ echo *.missing

OUTPUT

*.missing

BASH

$ ls *.missing

OUTPUT

ls: cannot access '*.missing': No such file or directory

Command History


If you want to repeat a command that you’ve run recently, you can access previous commands using the up arrow on your keyboard to go back to the most recent command. Likewise, the down arrow takes you forward in the command history.

A few more useful shortcuts:

  • Ctrl+C will cancel the command you are writing, and give you a fresh prompt.
  • Ctrl+R will do a reverse-search through your command history. This is very useful.
  • Ctrl+L or the clear command will clear your screen.

You can also review your recent commands with the history command, by entering:

BASH

$ history

to see a numbered list of recent commands. You can reuse one of these commands directly by referring to the number of that command.

For example, if your history looked like this:

OUTPUT

259  ls *
260  ls /usr/bin/*.sh
261  ls *R1*fastq

then you could repeat command #260 by entering:

BASH

$ !260

Type ! (exclamation point) and then the number of the command from your history. You will be glad you learned this when you need to re-run very complicated commands. For more information on advanced usage of history, read section 9.3 of Bash manual.

Exercise

Find the line number in your history for the command that listed all the .sh files in /usr/bin. Rerun that command.

First type history. Then use ! followed by the line number to rerun that command.

Examining Files


We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files?

One way to examine a file is to print out all of the contents using the program cat.

Enter the following command from within the untrimmed_fastq directory:

BASH

$ cat SRR097977.fastq

This will print out all of the contents of the SRR097977.fastq to the screen.

Exercise

  1. Print out the contents of the /broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq file. What is the last line of the file?
  2. From your home directory, and without changing directories, use one short command to print the contents of all of the files in the /broad/hptmp/computing_basics/untrimmed_fastq directory.
  1. The last line of the file is CCC?CCCCCCC?CCCC?CCC>:CC:C>8C8?97A?'.
  2. cat /broad/hptmp/computing_basics/untrimmed_fastq/*

cat is a terrific program, but when the file is really big, it can be annoying to use. The program, less, is useful for this case. less opens the file as read only, and lets you navigate through it. The navigation commands are identical to the man program.

Enter the following command:

BASH

$ less SRR097977.fastq

Some navigation commands in less:

key action
Space to go forward
b to go backward
g to go to the beginning
G to go to the end
q to quit

less also gives you a way of searching through files. Use the “/” key to begin a search. Enter the word you would like to search for and press enter. The screen will jump to the next location where that word is found.

Shortcut: If you hit “/” then “enter”, less will repeat the previous search. less searches from the current location and works its way forward. Scroll up a couple lines on your terminal to verify you are at the beginning of the file. Note, if you are at the end of the file and search for the sequence “CAA”, less will not find it. You either need to go to the beginning of the file (by typing g) and search again using / or you can use ? to search backwards in the same way you used / previously.

For instance, let’s search forward for the sequence TTTTT in our file. You can see that we go right to that sequence, what it looks like, and where it is in the file. If you continue to type / and hit return, you will move forward to the next instance of this sequence motif. If you instead type ? and hit return, you will search backwards and move up the file to previous examples of this motif.

Exercise

What are the next three nucleotides (characters) after the first instance of the sequence quoted above?

CAC

Remember, the man program actually uses less internally and therefore uses the same commands, so you can search documentation using “/” as well!

There’s another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it’s formatted.

The commands are head and tail and they let you look at the beginning and end of a file, respectively.

BASH

$ head SRR098026.fastq

OUTPUT

@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
+SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
@SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN
+SRR098026.2 HWUSI-EAS1599_1:2:1:0:312 length=35
!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!
@SRR098026.3 HWUSI-EAS1599_1:2:1:0:570 length=35
NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNN

BASH

$ tail SRR098026.fastq

OUTPUT

+SRR098026.247 HWUSI-EAS1599_1:2:1:2:1311 length=35
#!##!#################!!!!!!!######
@SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
GNTGNGGTCATCATACGCGCCCNNNNNNNGGCATG
+SRR098026.248 HWUSI-EAS1599_1:2:1:2:118 length=35
B!;?!A=5922:##########!!!!!!!######
@SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
CNCTNTATGCGTACGGCAGTGANNNNNNNGGAGAT
+SRR098026.249 HWUSI-EAS1599_1:2:1:2:1057 length=35
A!@B!BBB@ABAB#########!!!!!!!######

The -n option to either of these commands can be used to print the first or last n lines of a file.

BASH

$ head -n 1 SRR098026.fastq

OUTPUT

@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35

BASH

$ tail -n 1 SRR098026.fastq

OUTPUT

A!@B!BBB@ABAB#########!!!!!!!######

Details on the FASTQ format


Although it looks complicated (and it is), it’s easy to understand the fastq format with a little decoding. Some rules about the format include…

Line Description
1 Always begins with ‘@’ and then information about the read
2 The actual DNA sequence
3 Always begins with a ‘+’ and sometimes the same info in line 1
4 Has a string of characters which represent the quality scores; must have same number of characters as line 2

We can view the first complete read in one of the files in our dataset by using head to look at the first four lines.

BASH

$ head -n 4 SRR098026.fastq

OUTPUT

@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
+SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!

All but one of the nucleotides in this read are unknown (N). This is a pretty bad read!

Line 4 shows the quality for each nucleotide in the read. Quality is interpreted as the probability of an incorrect base call (e.g. 1 in 10) or, equivalently, the base call accuracy (e.g. 90%). To make it possible to line up each individual nucleotide with its quality score, the numerical score is converted into a code where each individual character represents the numerical quality score for an individual nucleotide. For example, in the line above, the quality score line is:

OUTPUT

!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!

The # character and each of the ! characters represent the encoded quality for an individual nucleotide. The numerical value assigned to each of these characters depends on the sequencing platform that generated the reads. The sequencing machine used to generate our data uses the standard Sanger quality PHRED score encoding, Illumina version 1.8 onwards. Each character is assigned a quality score between 0 and 42 as shown in the chart below.

OUTPUT

Quality encoding: !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJK
                  |         |         |         |         |
Quality score:    0........10........20........30........40..

Each quality score represents the probability that the corresponding nucleotide call is incorrect. This quality score is logarithmically based, so a quality score of 10 reflects a base call accuracy of 90%, but a quality score of 20 reflects a base call accuracy of 99%. These probability values are the results from the base calling algorithm and dependent on how much signal was captured for the base incorporation.

Looking back at our read:

OUTPUT

@SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
NNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNN
+SRR098026.1 HWUSI-EAS1599_1:2:1:0:968 length=35
!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!

we can now see that the quality of each of the Ns is 0 and the quality of the only nucleotide call (C) is also very poor (# = a quality score of 2). This is indeed a very bad read.

Creating, moving, copying, and removing


Now we can move around in the file structure, look at files, and search files. But what if we want to copy files or move them around or get rid of them? Most of the time, you can do these sorts of file manipulations without the command line, but there will be some cases (like when you’re working with a remote computer like we are for this lesson) where it will be impossible. You’ll also find that you may be working with hundreds of files and want to do similar manipulations to all of those files. In cases like this, it’s much faster to do these operations at the command line.

Copying Files

When working with computational data, it’s important to keep a safe copy of that data that can’t be accidentally overwritten or deleted. For this lesson, our raw data is our FASTQ files. We don’t want to accidentally change the original files, so we’ll make a copy of them and change the file permissions so that we can read from, but not write to, the files.

First, let’s make a copy of one of our FASTQ files using the cp command.

Usually, you would do this in the untrimmed_fastq directory and the command would look like: cp SRR097977.fastq SRR097977-copy.fastq

but, because there are a lot of us, lets copy the file from the /broad/hptmp filesystem into our home directory.

START FROM YOUR HOME DIRECTORY

BASH

$ cd
$ pwd

OUTPUT

/home/unix/<username>

Confirm pwd says you’re in your home directory (/home/unix/).

BASH

$ cp /broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq SRR097977-copy.fastq
$ ls -F

OUTPUT

SRR097977-copy.fastq  cb_unix_shell  cb_unix_shell.tgz

We now have a copy of the SRR097977.fastq file, named SRR097977-copy.fastq. We’ll move this file to a new directory called backup where we’ll store our backup data files.

Creating Directories

The mkdir command is used to make a directory. Enter mkdir followed by a space, then the directory name you want to create:

BASH

$ mkdir backup

Moving / Renaming

We can now move our backup file to this directory. We can move files around using the command mv:

BASH

$ mv SRR097977-copy.fastq backup
$ ls backup

OUTPUT

SRR097977-copy.fastq

The mv command is also how you rename files. Let’s rename this file to make it clear that this is a backup:

BASH

$ cd backup
$ mv SRR097977-copy.fastq SRR097977-backup.fastq
$ ls

OUTPUT

SRR097977-backup.fastq

File Permissions

We’ve now made a backup copy of our file, but just because we have two copies, it doesn’t make us safe. We can still accidentally delete or overwrite both copies. To make sure we can’t accidentally mess up this backup file, we’re going to change the permissions on the file so that we’re only allowed to read (i.e. view) the file, not write to it (i.e. make new changes).

View the current permissions on a file using the -l (long) flag for the ls command:

BASH

$ ls -l

OUTPUT

-rw-rw-r-- 1 jlchang root  879991940 May  1 00:29 SRR097977-backup.fastq

Note: your output will show your username where you see jlchang above.

The first part of the output for the -l flag gives you information about the file’s current permissions. There are ten slots in the permissions list. The first character in this list is related to file type, not permissions, so we’ll ignore it for now. The next three characters relate to the permissions that the file owner has, the next three relate to the permissions for group members, and the final three characters specify what other users outside of your group can do with the file. We’re going to concentrate on the three positions that deal with your permissions (as the file owner).

Permissions breakdown

Here the three positions that relate to the file owner are rw-. The r means that you have permission to read the file, the w indicates that you have permission to write to (i.e. make changes to) the file, and the third position is a -, indicating that you don’t have permission to carry out the ability encoded by that space (this is the space where x or executable ability is stored, we’ll talk more about this in a later lesson).

Our goal for now is to change permissions on this file so that you no longer have w or write permissions. We can do this using the chmod (change mode) command and subtracting (-) the write permission -w.

BASH

$ chmod -w SRR098026-backup.fastq
$ ls -l

OUTPUT

-r--r--r-- 1 jlchang root  879991940 May  1 00:29 SRR097977-backup.fastq

Note: your output will show your username where you see jlchang above.

Removing

To prove to ourselves that you no longer have the ability to modify this file, try deleting it with the rm command:

BASH

$ rm SRR098026-backup.fastq

You’ll be asked if you want to override your file permissions:

OUTPUT

rm: remove write-protected regular file ‘SRR098026-backup.fastq'?

You should enter n for no. If you enter n (for no), the file will not be deleted. If you enter y, you will delete the file. This gives us an extra measure of security, as there is one more step between us and deleting our data files.

Important: The rm command permanently removes the file. Be careful with this command. It doesn’t just nicely put the files in the Trash. They’re really gone.

By default, rm will not delete directories. You can tell rm to delete a directory using the -r (recursive) option. Let’s delete the backup directory we just made.

Enter the following command:

BASH

$ cd ..
$ rm -r backup

This will delete not only the directory, but all files within the directory. If you have write-protected files in the directory, you will be asked whether you want to override your permission settings.

Exercise

Starting in your home directory directory, do the following:

  1. Make sure that you have deleted your backup directory and all files it contains.
  2. Create a backup of each of our FASTQ files using cp. (Note: You’ll need to do this individually for each of the two FASTQ files. We haven’t learned yet how to do this with a wildcard.)
  3. Use a wildcard to move all of your backup files to a new backup directory.
  4. Change the permissions on all of your backup files to be write-protected.
  1. rm -r backup
  2. cp /broad/hptmp/computing_basics/untrimmed_fastq/SRR098026.fastq SRR098026-backup.fastq and cp /broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq SRR097977-backup.fastq
  3. mkdir backup and mv *-backup.fastq backup
  4. chmod -w backup/*-backup.fastq It’s always a good idea to check your work with ls -l backup. You should see something like:

OUTPUT

-rw-rw-r-- 1 jlchang puppet  49504900 May  9 08:09 SRR097977-backup.fastq
-rw-rw-r-- 1 jlchang puppet 111148244 May  9 08:09 SRR098026-backup.fastq

Key Points

  • You can view file contents using less, cat, head or tail.
  • The commands cp, mv, and mkdir are useful for manipulating existing files and creating new directories.
  • You can view file permissions using ls -l and change permissions using chmod.
  • The history command and the up arrow on your keyboard can be used to repeat recently used commands.

Content from Redirection


Last updated on 2024-05-09 | Edit this page

Estimated time: 45 minutes

Overview

Questions

  • How can I search within files?
  • How can I combine existing commands to do new things?

Objectives

  • Employ the grep command to search for information within files.
  • Print the results of a command to a file.
  • Construct command pipelines with two or more stages.
  • Use for loops to run the same command for several input files.

Searching files


We discussed in a previous episode how to search within a file using less. We can also search within files without even opening them, using grep. grep is a command-line utility for searching plain-text files for lines matching a specific set of characters (sometimes called a string) or a particular pattern (which can be specified using something called regular expressions). We’re not going to work with regular expressions in this lesson, and are instead going to specify the strings we are searching for. Let’s give it a try!

Nucleotide abbreviations

The four nucleotides that appear in DNA are abbreviated A, C, T and G. Unknown nucleotides are represented with the letter N. An N appearing in a sequencing file represents a position where the sequencing machine was not able to confidently determine the nucleotide in that position. You can think of an N as being aNy nucleotide at that position in the DNA sequence.

We’ll search for strings inside of our fastq files. But first, we’re going to make some symlinks. If you’re a Mac user, you may be familiar with right-click to Make Alias; On Windows, you’d right-click to Create Shortcut. A symlink points to a file without making another copy. NOT copying large files saves money on storage costs!

BASH

$ ln -s /broad/hptmp/computing_basics/untrimmed_fastq/SRR098026.fastq SRR098026.fastq
$ ln -s /broad/hptmp/computing_basics/untrimmed_fastq/SRR097977.fastq SRR097977.fastq
$ ls -F

OUTPUT

SRR097977.fastq@  SRR098026.fastq@  cb_unix_shell/  cb_unix_shell.tgz
Now with the sequence files symlinked, we can each work in our own home directory and we won’t accidentally get in each other’s way in /broad/hptmp/computing_basics.

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).

Determining quality

In this lesson, we’re going to be manually searching for strings of Ns within our sequence results to illustrate some principles of file searching. It can be really useful to do this type of searching to get a feel for the quality of your sequencing results, however, in your research you will most likely use a bioinformatics tool that has a built-in program for filtering out low-quality reads. You’ll learn how to use one such tool in a later lesson.

Let’s search for the string NNNNNNNNNN in the SRR098026 file:

BASH

$ grep NNNNNNNNNN SRR098026.fastq

This command returns a lot of output to the terminal. Every single line in the SRR098026 file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is. We may be interested not only in the actual sequence which contains this string, but in the name (or identifier) of that sequence. We discussed in a previous lesson that the identifier line immediately precedes the nucleotide sequence for each read in a FASTQ file. We may also want to inspect the quality scores associated with each of these reads. To get all of this information, we will return the line immediately before each match and the two lines immediately after each match.

We can use the -B argument for grep to return a specific number of lines before each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each matching line, so we add -B1 -A2 to our grep command:

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq

One of the sets of lines returned by this command is:

OUTPUT

@SRR098026.599947 HWUSI-EAS1599_1:2:4:1280:2025 length=35
TCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.599947 HWUSI-EAS1599_1:2:4:1280:2025 length=35
###!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Exercise

  1. Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  2. Search for the sequence AAGTT in both FASTQ files. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  1. grep -B1 GNATNACCACTTCC SRR098026.fastq
@SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
  1. grep -B1 AAGTT *.fastq
SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
--
SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
--
SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
[...clip...]
SRR098026.fastq-@SRR098026.599758 HWUSI-EAS1599_1:2:4:1278:392 length=35
SRR098026.fastq:TCAATGCCGGGCAAGTTCGTACAACACGTAGTGCA
--
SRR098026.fastq-@SRR098026.599795 HWUSI-EAS1599_1:2:4:1278:616 length=35
SRR098026.fastq:GTGAGATTGGGAAAGTTTGCACTCATGGGGGAAGG
--
SRR098026.fastq-@SRR098026.599944 HWUSI-EAS1599_1:2:4:1280:742 length=35
SRR098026.fastq:ACAAGAAGTTAACAACCATATAACCTGCACAGGAC

Redirecting output


grep allowed us to identify sequences in our FASTQ files that match a particular pattern. All of these sequences were printed to our terminal screen, but in order to work with these sequences and perform other operations on them, we will need to capture that output in some way.

We can do this with something called “redirection”. The idea is that we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. In our case, we want to print this information to a file so that we can look at it later and use other commands to analyze this data.

The command for redirecting output to a file is >.

Let’s try out this command and copy all the records (including all four lines of each record) in our FASTQ files that contain ‘NNNNNNNNNN’ to another file called bad_reads.txt.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt

File extensions

You might be confused about why we’re naming our output file with a .txt extension. After all, it will be holding FASTQ formatted data that we’re extracting from our FASTQ files. Won’t it also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to name it with a .fastq extension. However, using a .fastq extension will lead us to problems when we move to using wildcards later in this episode. We’ll point out where this becomes important. For now, it’s good that you’re thinking about file extensions!

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should see a new file called bad_reads.txt.

We can check the number of lines in our new file using a command called wc. wc stands for word count. This command counts the number of words, lines, and characters in a file. The FASTQ file may change over time, so given the potential for updates, make sure your file matches your instructor’s output.

As of Sept. 2020, wc gives the following output:

BASH

$ wc bad_reads.txt

OUTPUT

  68623  124599 2641459 bad_reads.txt

This will tell us the number of lines, words and characters in the file. If we want only the number of lines, we can use the -l flag for lines.

BASH

$ wc -l bad_reads.txt

OUTPUT

68623 bad_reads.txt

Exercise

How many sequences are there in SRR098026.fastq? Remember that every sequence is formed by four lines.

BASH

$ wc -l SRR098026.fastq

OUTPUT

2400000

Now you can divide this number by four to get the number of sequences in your fastq file.

This can be done using shell integer arithmetic

BASH

$ echo $((2400000/4))

Note, this will do integer division - if you need floating point arithmetic you can use bc - an arbitrary precision calculator

BASH

$ echo "2400000/4" | bc

OUTPUT

600000

Exercise

How many sequences in SRR098026.fastq contain at least 3 consecutive Ns?

BASH

$ grep NNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

17687 bad_reads.txt

We might want to search multiple FASTQ files for sequences that match our search pattern. However, we need to be careful, because each time we use the > command to redirect output to a file, the new output will replace the output that was already present in the file. This is called “overwriting” and, just like you don’t want to overwrite your video recording of your kid’s first birthday party, you also want to avoid overwriting your data files.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

68623 bad_reads.txt

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

523 bad_reads.txt

Here, the output of our second call to wc shows that we no longer have 68623 lines in our bad_reads.txt file. This is because the second file we searched (SRR097977.fastq) only has 523 lines that match our search sequence. So our file was overwritten.

We can avoid overwriting our files by using the command >>. >> is known as the “append redirect” and will append new output to the end of a file, rather than overwriting it.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

68623 bad_reads.txt

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

69146 bad_reads.txt

The output of our second call to wc shows that we have added more bad reads to our original data.

We can also do this with a single line of code by using a wildcard:

BASH

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
$ wc -l bad_reads.txt

OUTPUT

69147 bad_reads.txt

Pilot Unix workshop edits stop here

File extensions - part 2

This is where we would have trouble if we were naming our output file with a .fastq extension. If we already had a file called bad_reads.fastq (from our previous grep practice) and then ran the command above using a .fastq extension instead of a .txt extension, grep would give us a warning.

BASH

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq

OUTPUT

grep: input file ‘bad_reads.fastq' is also the output

grep is letting you know that the output file bad_reads.fastq is also included in your grep call because it matches the *.fastq pattern. Be careful with this as it can lead to some unintended results.

Since we might have multiple different criteria we want to search for, creating a new output file each time has the potential to clutter up our workspace. We also thus far haven’t been interested in the actual contents of those files, only in the number of reads that we’ve found. We created the files to store the reads and then counted the lines in the file to see how many reads matched our criteria. There’s a way to do this, however, that doesn’t require us to create these intermediate files - the pipe command (|).

This is probably not a key on your keyboard you use very much, so let’s all take a minute to find that key. In the UK and US keyboard layouts, and several others, the | character can be found using the key combination Shift+</kbd>. This may be different for other language-specific layouts.

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. When our output was scrolling by, we might have wished we could slow it down and look at it, like we can with less. Well it turns out that we can! We can redirect our output from our grep call through the less command.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less

We can now see the output from our grep call within the less interface. We can use the up and down arrows to scroll through the output and use q to exit less.

If we don’t want to create a file before counting lines of output from our grep search, we could directly pipe the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure you would like to save it to a file.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by four to get the number of sequences that match our search pattern. Since 802 / 4 = 200.5 and we are expecting an integer number of records, there is something added or missing in bad_reads.txt. If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ tail bad_reads.txt

OUTPUT

@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
--
--
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The fifth and six lines in the output display “–” which is the default action for grep to separate groups of lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

BASH

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.fastq
$ tail bad_reads.fastq

OUTPUT

+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The -v option in the second grep search stands for --invert-match meaning grep will now only display the lines which do not match the searched pattern, in this case '^--'. The caret (^) is an anchoring character matching the beginning of the line, and the pattern has to be enclose by single quotes so grep does not interpret the pattern as an extended option (starting with –).

Custom grep control

Use man grep to read more about other options to customize the output of grep including extended options, anchoring characters, and much more.

Redirecting output is often not intuitive, and can take some time to get used to. Once you’re comfortable with redirection, however, you’ll be able to combine any number of commands to do all sorts of exciting things with your data!

None of the command line programs we’ve been learning do anything all that impressive on their own, but when you start chaining them together, you can do some really powerful things very efficiently.

File manipulation and more practices with pipes

To practice a bit more with the tools we’ve added to our tool kit so far and learn a few extra ones you can follow this extra lesson which uses the SRA metadata file.

Writing for loops

Loops are key to productivity improvements through automation as they allow us to execute commands repeatedly. Similar to wildcards and tab completion, using loops also reduces the amount of typing (and typing mistakes). Loops are helpful when performing operations on groups of sequencing files, such as unzipping or trimming multiple files. We will use loops for these purposes in subsequent analyses, but will cover the basics of them for now.

When the shell sees the keyword for, it knows to repeat a command (or group of commands) once for each item in a list. Each time the loop runs (called an iteration), an item in the list is assigned in sequence to the variable, and the commands inside the loop are executed, before moving on to the next item in the list. Inside the loop, we call for the variable’s value by putting $ in front of it. The $ tells the shell interpreter to treat the variable as a variable name and substitute its value in its place, rather than treat it as text or an external command. In shell programming, this is usually called “expanding” the variable.

Sometimes, we want to expand a variable without any whitespace to its right. Suppose we have a variable named foo that contains the text abc, and would like to expand foo to create the text abcEFG.

BASH

$ foo=abc
$ echo foo is $foo
foo is abc
$ echo foo is $fooEFG      # doesn't work
foo is

The interpreter is trying to expand a variable named fooEFG, which (probably) doesn’t exist. We can avoid this problem by enclosing the variable name in braces ({ and }, also called “curly brackets”). bash treats the # character as a comment character. Any text on a line after a # is ignored by bash when evaluating the text as code.

BASH

$ foo=abc
$ echo foo is $foo
foo is abc
$ echo foo is ${foo}EFG      # now it works!
foo is abcEFG

Let’s write a for loop to show us the first two lines of the fastq files we downloaded earlier. You will notice the shell prompt changes from $ to > and back again as we were typing in our loop. The second prompt, >, is different to remind us that we haven’t finished typing a complete command yet. A semicolon, ;, can be used to separate two commands written on a single line.

BASH

$ cd ../untrimmed_fastq/

BASH

$ for filename in *.fastq
> do
> head -n 2 ${filename}
> done

The for loop begins with the formula for <variable> in <group to iterate over>. In this case, the word filename is designated as the variable to be used over each iteration. In our case SRR097977.fastq and SRR098026.fastq will be substituted for filename because they fit the pattern of ending with .fastq in the directory we’ve specified. The next line of the for loop is do. The next line is the code that we want to execute. We are telling the loop to print the first two lines of each variable we iterate over. Finally, the word done ends the loop.

After executing the loop, you should see the first two lines of both fastq files printed to the terminal. Let’s create a loop that will save this information to a file.

BASH

$ for filename in *.fastq
> do
> head -n 2 ${filename} >> seq_info.txt
> done

When writing a loop, you will not be able to return to previous lines once you have pressed Enter. Remember that we can cancel the current command using

  • Ctrl+C

If you notice a mistake that is going to prevent your loop for executing correctly.

Note that we are using >> to append the text to our seq_info.txt file. If we used >, the seq_info.txt file would be rewritten every time the loop iterates, so it would only have text from the last variable used. Instead, >> adds to the end of the file.

Using Basename in for loops

Basename is a function in UNIX that is helpful for removing a uniform part of a name from a list of files. In this case, we will use basename to remove the .fastq extension from the files that we’ve been working with.

BASH

$ basename SRR097977.fastq .fastq

We see that this returns just the SRR accession, and no longer has the .fastq file extension on it.

OUTPUT

SRR097977

If we try the same thing but use .fasta as the file extension instead, nothing happens. This is because basename only works when it exactly matches a string in the file.

BASH

$ basename SRR097977.fastq .fasta

OUTPUT

SRR097977.fastq

Basename is really powerful when used in a for loop. It allows to access just the file prefix, which you can use to name things. Let’s try this.

Inside our for loop, we create a new name variable. We call the basename function inside the parenthesis, then give our variable name from the for loop, in this case ${filename}, and finally state that .fastq should be removed from the file name. It’s important to note that we’re not changing the actual files, we’re creating a new variable called name. The line > echo $name will print to the terminal the variable name each time the for loop runs. Because we are iterating over two files, we expect to see two lines of output.

BASH

$ for filename in *.fastq
> do
> name=$(basename ${filename} .fastq)
> echo ${name}
> done

Exercise

Print the file prefix of all of the .txt files in our current directory.

BASH

$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> echo ${name}
> done

One way this is really useful is to move files. Let’s rename all of our .txt files using mv so that they have the years on them, which will document when we created them.

BASH

$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> mv ${filename}  ${name}_2019.txt
> done

Exercise

Remove _2019 from all of the .txt files.

BASH

$ for filename in *_2019.txt
> do
> name=$(basename ${filename} _2019.txt)
> mv ${filename} ${name}.txt
> done

Key Points

  • grep is a powerful search tool with many options for customization.
  • >, >>, and | are different ways of redirecting output.
  • command > file redirects a command’s output to a file.
  • command >> file redirects a command’s output to a file without overwriting the existing contents of the file.
  • command_1 | command_2 redirects the output of the first command as input to the second command.
  • for loops are used for iteration.
  • basename gets rid of repetitive parts of names.